Strona
Główna

Badania
Molekularne

Analiza
Statystyczna

Analiza
Informatyczna

Linki
Kontakt

Forum
Dyskusyjne



Markery genetyczne i ich zastosowanie w praktyce hodowlanej


          Określenie "marker genetyczny" dotyczy polimorficznych cech jakościowych organizmu, które charakteryzuje proste dziedziczenie mendlowskie oraz które można dokładnie identyfikować metodami analitycznymi. Polimorficznosc oznacza występowanie w tym samym lokus kilku lub kilkunastu różnych sekwencji DNA. Markery genetyczne dzielimy na dwie klasy; klasa I są to geny kodujące cechy jakościowe organizmu, natomiast markerami genetycznymi klasy II są niekodujące sekwencje DNA.
          Do markerów genetycznych klasy I zalicza się: antygeny erytrocytarne, czyli mówimy tu o układach grupowych krwi, antygenowe determinanty białek surowicy krwi, czyli allotypy immunoglobulin, czy też allotypy lipoprotein, białka polimorficzne występujące w osoczu krwi, erytrocytów, mleka, białka jaj ptaków, antygeny leukocytarne oraz powierzchniowe komórek jądrzastych, czyli antygeny głównego układu zgodności tkankowej (Major Histocompatibility Complex - MHC). Markery genetyczne klasy tej identyfikuje się metodami serologicznymi lub metodami elektroforetycznymi.
          Natomiast markery genetyczne klasy II identyfikowane są przy użyciu technik analizy molekularnej. Gdzie na pierwszy plan wysunęła się łańcuchowej reakcja polimerazy, (Polymerase Cham Reaction - PCR) wraz z metodami elektroforetycznymi i hybrydyzacji z sondą molekularną. Markerami genetycznymi klasy II, czyli odcinkami niekodującymi są:


Polimorfizm długości fragmentów restrykcyjnych (RFLPs)


          Polimorfizm długości fragmentów restrykcyjnych (RFLPs) jest związany jest z występowaniem różnic w sekwencjach nukleotydowych w obrębie genu. Innymi słowy polimorfizm ten jest wynikiem punktowych mutacji, występujących w obrębie genu Różnice te w postaci zamiany pewnych nukleotydów na inne mogą nie przejawiać się fenotypowo natomiast ujawniają się dzięki zastosowaniu enzymów restrykcyjnych z palety kilkuset, które rozpoznają typowe dla siebie sekwencje nukleotydowe. Mutacje mogą wiec powodować powstawanie nowych miejsc rozpoznawanych przez enzymy restrykcyjne. Tną one wtedy DNA na fragmenty o zróżnicowanej długości. Elektroforeza ujawnia skład uzyskanej mieszaniny DNA. Różne formy tego genu dziedziczą się w prosty mendlowski sposób. Czyli jedna sekwencji z pary pochodzi jest losowo pozyskana od matki a sekwencja na homologicznym chromosomie z pary pochodzi od ojca i jest również losowa.
          Wyobraźmy sobie przykład takiego badania, do którego zastosujemy enzym restrykcyjny HaeIII z Haemophilus aegypticus. Enzym ten rozpoznaje i przecina poniższą sekwencję, w wyniku, czego powstają "tępe końce".

5' GGCC 3' ................ 5' GG ... CC 3'
3' CCGG 5' ................ 3' CC ... GG 5'

          Rozpatrzmy teraz hipotetyczną sekwencje DNA. Biorąc pod uwagę poniższy odcinek DNA po zastosowaniu do trawienia enzymu HaeIII otrzymamy dwa odcinki o wielkości 9pz i 49 pz, gdyż enzym ten odnajduje jedno miejsce rozpoznawane przez niego jako restrykcyjne. Jeśli jednak w pozycji 30 dojdzie do mutacji, w której T zastąpiona zostanie na C natomiast A zastąpiona zostanie G. Powstaną dwa takie miejsca restrykcyjne.

          Wyjściowa sekwencja ma taką postać gdzie kolorem czerwonym zaznaczono miejsce rozpoznawane przez enzym estrykcyjny.

ACTCAGAGGCCATGCTAGCTGATCGTGGCTAGTCGATAAGCTGACTAGCTGACGCTGA
TGAGTCTCCGGTACGATCGACTAGCACCGATCAGCTATTCGACTGATCGACTGCGACT

          Przy genotypie, w którym w obu loci znajduje się taki sam odcinek DNA określony jako allel Q otrzymujemy po procesie elektroforezy dwa prążki o wielkości 9pz i 49pz.
          Teraz sytuacja, gdy w sekwencji tej dochodzi do mutacji.

ACTCAGAGGCCATGCTAGCTGATCGTGGCTAGTCGATAAGCTGACTAGCTGACGCTGA
TGAGTCTCCGGTACGATCGACTAGCACCGATCAGCTATTCGACTGATCGACTGCGACT

ACTCAGAGGCCATGCTAGCTGATCGTGGCCAGTCGATAAGCTGACTAGCTGACGCTGA
TGAGTCTCCGGTACGATCGACTAGCACCGGTCAGCTATTCGACTGATCGACTGCGACT

          W zmutowanym allelu enzym ten odnajdzie już nie jeden a dwa miejsca restrykcyjne i rozetnie on, więc ten odcinek w dwóch miejscach na trzy odcinki. Przy genotypie, w którym w obu loci znajduje się taki sam odcinek zmutowanego DNA określony jako allel q otrzymujemy po procesie elektroforezy trzy prążki o wielkości 9pz, 19pz i 30pz.
          Jeżeli jednak mamy, doczynienia z osobnikiem heterozygotycznym Q/q to w procesie elektroforezy powstaną aż cztery prążki o wielkości 9pz, 19pz, 30pz oraz 49pz.

ACTCAGAGGCCATGCTAGCTGATCGTGGCCAGTCGATAAGCTGACTAGCTGACGCTGA
TGAGTCTCCGGTACGATCGACTAGCACCGATCAGCTATTCGACTGATCGACTGCGACT


Minisatelitarny polimorfizm DNA


          Minisatelitarny polimorfizm DNA odkryty został w 1985 roku. Miejsca takie to sekwencje zawierające zmienną liczbę tandemowych powtórzeń kilkunasto- lub kilkudziesięciu nukleotydowego motywu. W zależności od ilości powtórzeń fragment taki ma charakterystyczną długość. Może ona być badana tą samą metodą PCR wraz z elektroforezą, połączoną z hybrydyzacją z wyznakowaną sondą. Liczba powtórzeń decyduje o długości fragmentu, co z kolei wpływa na szybkości jego przemieszczania się podczas elektroforezy. Genomy zwierząt jak i ludzki są w znacznym stopniu naszpikowane loci, zawierającymi sekwencje tandemowych powtórzeń konkretnego motywu nukleotydowego. Wykonanie analizy DNA każdego organizmu polega na uzyskaniu charakterystycznego osobniczo układu prążków na elektofogramie i hybrydyzacji tego produktu z wyznakowaną sondą, reprezentującą konkretną sekwencję powtarzalną. Układ takich prążków nazywany jest odciskiem palca DNA inaczej DNA fingerpriting, wykorzystywany między innymi w kontroli rodowodów.

          Przykładowy motyw powtórzeń sekwencji minisatelitarnej może mieć postać; AGGGCTGGAGG

           Allel 1.
          AGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGG
           Allel 2.
          AGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGG
           Allel 3.
          AGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGGAGGGCTGGAGG
           itd.

          Oczywiście w rzeczywistośc ilośc powtórzeń nie jest tak mała jak w przykładzie. W badaniach mamy doczynienia z kilkudziesięcioma powtórzeniami sekwencji minisatelitarnej, występującymi najczęściej w telomerowych fragmentach chromosomów..


Mikrosatelitarny polimorfizm DNA


          Najpopularniejsze są w badaniach odcinki mikrosatelitarnego DNA. Sekwencje mikrosatelitarne są to proste, tandemowe powtórzenia składające się z dwu-, trzy- lub czteronukleotydowych sekwencji zwanych motywami. Najczęściej są to jednak dwunukleotydowe motywy powtórzeń. Często motyw taki może być, regularnie przerywany inną sekwencją. Jako odcinki niekodujące ulokowane są zazwyczaj w intronach jednak czasami znajdujemy je również eksonach w postaci mniejszej liczby powtórzeń. Dzięki dużemu zróżnicowaniu ilości powtórzeń motywu podstawowego jego polimorfizm jest ogromny, co w połączeniu z prostym mendlowskim dziedziczeniem tworzy idealny obiekt badań, co jeszcze potęguje równomierność rozmieszczenia w genomach. Polimorfizm jest tak wielki, że poziom heterozygotyczności w lokus mikrosatelitarnych wynosi przeciętnie 80%. Frekwencję mutacji w takich, loci szacuje się na około 0,001 w lokus na pokolenie.
          Także i tu pomocna staje się łańcuchowa reakcja polimerazy, (Polymerase Cham Reaction - PCR), dzięki znajomości fragmentów flankujących identyfikuje obecne w genomie fragmenty. Po rozdziale na żelu lub po hybrydyzacji ze znana sondą dowiadujemy się, jakiej długości mikrosatelita występuje u badanego osobnika pod względem analizowanego loci. Jeżeli zastosujemy metodę multiplex PCR otrzymamy cały zestaw prążków do przeanalizowania. Tę metodę identyfikacji mikrosatelitów wykorzystuje się często w kontroli pochodzenia zwierząt, gdy chcemy sprawdzić poprawność zapisów do procesu szacowania wartości hodowlanej czy też sprawdzić pochodzenie szczególnie cennych osobników, jak na przykład psy z rodowodem.

          Przykładowy motyw powtórzeń sekwencji mikrosatelitarnej może mieć postać; CATA

           Allel 1.
          CATACATACATACATACATACATACATACATACATACATACATACATA
           Allel 2.
          CATACATACATACATACATACATACATACATACATACATACATA
           Allel 3.
          CATACATACATACATACATACATACATACATACATACATA
           itd.

           Sekwencje mikrosatelitarne są równomiernie rozsianymi elementami w genomie. Dzięki temu znalazły wiele praktycznych zastosowań między innymi w poszukiwaniu genów cech ilościowych QTL oraz przy tworzeniu map genetycznych.


Polimorfizm losowo amplifikowanych fragmentów DNA (RAPD)


          Badania przy użyciu analizy takich fragmentów DNA polegają na amplifikacji techniką PCR uprzednio zebranego materiału genetycznego bez wcześniejszego określenia sekwencji starterów ani sond molekularnych. Polega to na użyciu starterów o losowej sekwencji nukleotydowej. Sekwencja taka ma zazwyczaj wielkość 10 nukleotydów, z czego większą część stanowią nukleotydy guaninowe - G i cytozynowe - C. Po sączonym procesie amplifikacji otrzymujemy produkt pochodzący zazwyczaj z kilku loci w genomie. Jeśli zastosujemy taką samą procedurę z tymi samymi primerami do analizy materiału genetycznego pochodzącego od kilku czy kilkunastu osobników, to otrzymane różnice wielkości amplifikowanych fragmentów DNA można poddać analizie. Przeprowadzić można wtedy proces sekwencjonowania. Stwierdzamy wtedy gdzie i jakie mutacja punktowe powodują te różnice w sekwencji poszczególnych odcinków.
          Odcinki te to oczywiście fragmenty DNA w skład, których wchodzą sekwencje kodujące i niekodujące gdyż amplifikacja jest w tym przypadku losowa. Po dokładnym zanalizowanego materiału otrzymujemy lokus, który może być użyty jako marker genetyczny. Markery takie nazywamy skrótem SCAR od angielskich słów sequence characterized amplifield region.


Praktyczne wykorzystanie markerów mikrosatelitarnych


          Obecnie znamy wiele zastosowań praktycznych dla sekwencji mikrosatelitarnych. Nie zmienia to faktu, że na razie funkcja sekwencji mikrosatelitarnych w organizmie nie jest do końca jasna. Sekwencje, mikrosatelitarne jako markery genetyczne wykorzystywane są w hodowli zwierząt w następujących badaniach; identyfikacji genów cech ilościowych QTL, które warunkowane są dużą ilością genów, więc nie mamy doczynienia z zasadą "jeden gen jedna cecha", czasem jednak mówimy osobników genach głównych cech ilościowych i do identyfikacji takich osobników niosących ten gen główny również pomocne mogą być sprzężony z nimi sekwencje mikrosatelitarne. Sekwencje te po za tym pomagają w charakterystyce struktury genetycznej populacji wraz z określaniem stopnia pokrewieństwa i stopnia, zinbredowania populacji oraz szacowanie zmienności genetycznej zwierząt. Analiza ich rozkładu pozwała na przykład ustalić, czy badana populacja znajduje się w stanie równowagi genetycznej, czy też równowaga ta została już zachwiana. Markery takie są też źródłem informacji do oszacowania stopnia homo- i heterozygotyczności populacji. Badania kontroli pochodzenia, rozciągnąć się mogą do badań dystansu genetycznego pomiędzy rasami, populacjami czy określonymi liniami zwierząt. Czy wręcz do badań filogenetycznych. Kończąc oczywiście na konstrukcji genetycznych map sprzężeniowych genomów zwierząt domowych. Genetyczne mapy sprzężeniowe stały się bardzo ważnym narzędziem w pracy hodowlanej na poziomie molekularnym.
          Genetyczna zmienność zwierząt gospodarskich przez wiele lat określana była w na podstawie układów grupowych krwi lub na podstawie polimorfizmu różnego rodzaju białek. Określanie frekwencji różnych sekwencji w różnych loci sekwencji mikrosatelitarnych wykorzystuje się do obliczania parametrów zróżnicowania genetycznego w dowolnej populacji lub też pomiędzy populacjami. Szacunki takie dotyczące różnorodności genetycznej zwierząt określają proporcje polimorficznych loci, średnia heterozygotyczność oraz liczba alleli na lokus.
          Proporcja polimorficznych loci wskazuje nam ile spośród wszystkich loci jest w większym lub mniejszym stopniu, ale polimorficznym względem alleli. Dzięki temu parametrowi określamy, jaka część spośród wszystkich loci może zawierać więcej niż jeden możliwy allel. Im ten współczynnik jest większy tym możliwa jest większa potencjalna heterozygotyczność w genomie.

P - polimorficzność loci
Lm - liczba monomorficznych loci
Lp - liczba polimorficznych loci

          By określić liczbę tych polimorficznych loci stosujemy następujący wzór.


Lp - liczba polimorficznych loci
Vi - liczba zmiennych prążków dla i-tego osobnika
N - liczba osobników w populacji

          Prócz proporcji polimorficzności można również określić stopień polimorficzności danego locus. Służy do tego PIC skrót od angielskich słów Polymorphism Information Content).


pi - frekwencja i-tego allelu w populacji
pj - frekwencja j-tego allelu w populacji

          Kolejny parametr to współczynnik, heterozygotyczności, który można określić dla pojedynczego locus lub dla wielu loci. Dla jednego locus wzór na współczynnik heterozygotyczności ma postać.


H - Współczynnik heterozygotyczności
qi - frekwencja i-tego allelu w locus
N - liczba osobników w populacji

          Jeśli jednak interesuje nas obliczenie tego współczynnika przy uwzględnieniu większej liczby loci to wzór zmienia postać na;


H - Współczynnik heterozygotyczności
qi - frekwencja i-tego allelu w locus
N - liczba osobników w populacji
r - liczba wszystkich loci

          Badania dystansów genetycznych opierają się na fakcie podobieństw pomiędzy tymi sekwencjami u różnych gatunków. Umożliwia to, więc stosowanie w reakcji amplifikacji takich samych zestawów starterów dla amplifikacji materiału u różnych gatunków zwierząt. Więc wiele ze znanych starterów dla sekwencji mikrosatelitarnych stosowanych u bydła może być z powodzeniem stosowanych w reakcji amplifikacji analogicznych sekwencji u owiec, a nawet jelenia szlachetnego czy jelenia sika. Do matematycznego przedstawienia dystansu genetycznego najczęściej stosowane są zależności przedstawione poniżej mające zastosowanie wraz z markerami mikrosatelitarnymi.


xi - frekwencje i-tego allelu w locus w populacji X
yi - frekwencje i-tego allelu w locus w populacji Y
nx - liczebność osobników w populacji X
ny - liczebność osobników w populacji Y

          Jeżeli do badań dystansu genetycznego zastosowano polimorfizm minisatelitarny bądź też RAPD to uzyskany obraz jest w postaci prążków, które można za sobą porównywać. Właśnie na podstawie takiego porównania przypominającego metodę genetycznego odcisku palca można obliczyć indeks podobieństwa BS, skrót od angielskich słów band sharing). Wartość ta wskazuje nam, z jakim prawdopodobieństwem prążek wykryty w jednej z prób zostanie równocześnie wykryty w próbie kolejnej z innej populacji


Nab - liczba identycznych prążków w obu próbach
Na - całkowita liczba prążków w próbie "a"
Nb - całkowita liczba prążków w próbie "b"

          Z drugiej strony mikrosatelity te mogą pomóc w określaniu różnic pomiędzy blisko spokrewnionymi populacjami. Frekwencja poszczególnych alleli w danym lokus może być wykorzystana do przypisania z dużą dokładnością przynależności danego zwierzęcia do określonej rasy. Ostatnio wiele sekwencji mikrosatelitarnych bydła znalazło zastosowanie w analizach molekularnych u blisko spokrewnionych z nim gatunków, takich jak owce i kozy.
          Wyniki badań umożliwiają szacowanie czasu rozdziału różnych gatunków czy ras na przykład brytyjskie rasy owiec od merynosa oddzieliły się 1094 lat temu, natomiast merynos australijski i nowozelandzki 227 lat temu.
          W molekularnej kontroli pochodzenia wykorzystuje się kilka rodzajów polimorficznych markerów genetycznych. Polimorfizm długości fragmentów restrykcyjnych (RFLP) jest stosunkowo niski heterozygotycznie oraz posiada niski poziom polimorfizmu PIC. Minisatelitarne wzory prążkowe DNA są trudne do interpretacji ze względu na szerokie zróżnicowanie genetyczne. Natomiast markery mikrosatelitarne łączą w sobie wszystkie zalety gdyż maja wyższą heterozygotyczność i polimorfizm niż RFLPs, natomiast interpretacja wyników ich analizy jest łatwiejsza niż minisatelitarnych sekwencji DNA.
          Kontrola pochodzenia jest ważnym praktycznie aspektem pracy hodowlanej. Jest ona prowadzona na podstawie analizy dziedziczenia polimorficznych markerów genetycznych, w postaci sekwencji, minisatelitarnych. Po elektroforezie ujawnia się osobniczo specyficzny układ prążków. Układ ten często określany jest terminem DNA fingerprint, czyli odcisk palca DNA, lub genetyczny odcisk palca. Każdy powstały prążek reprezentuje oddzielny fragmenty DNA zawierający różną liczbę powtórzeń danej sekwencji minisatelitarnej. Analiza sekwencji mini i mikrosatelitarnych wykrywa polimorfizm równocześnie dla, wielu loci, możliwe jest to dzięki równoczesnemu prowadzeniu reakcji PCR dla kilku sekwencji, przy zastosowaniu odpowiedniej liczby par primerów, czyli wariantu PCR zwanej multiplex PCR.
          Funkcja mikrosatelitów są jeszcze nie do końca jasne. Sekwencje mini i mikrosatelitarne zaliczane są do tej części DNA, którą często nazywa się "śmieciowym DNA". To "śmieciowe" zastąpiłbym jednak bardziej przekonywującym "samolubnym". Rozpatrywanie tych elementów jako "samolubnego" w znaczeniu takim, jakie znajdziemy w książce Richarda Dawkinsa "Samolubny gen", może oszczędzić nam frustracji związanych z brakiem sensownej odpowiedzi na pytanie o sens istnienia takiego DNA.
          Jak na razie jedyne potwierdzone znaczenie tego DNA jest raczej negatywne, gdyż wykazano związek niektórych z nich i chorób neurologicznych. I nie chodzi tu wyłącznie o zależność statystyczną. W niektórych przypadkach zmienne sekwencje mikrosatelitarne zakłócają działanie innych genów. Większość, bo ponad 90% tych sekwencji leży poza genami. Natomiast ogromna ich ilość i obecność w okolicach gdzie swoje loci maja geny szlaków regulatorowych, powoduje, że niektórzy badacze poważnie traktują możliwość istnienia określonych funkcji tych odcinków DNA. Bardzo prawdopodobne jest, że mogą one mieć wpływ na ekspresję genów oraz na miejsca rekombinacji. Niektóre obserwacje sugerują, że mikrosatelity mogą działać jak elementy wzmacniające transkrypcję genu.